Source: International Congress Series (2003) 1239: 547-551, https://doi.org/10.1016/S0531-5131(02)00570-8
The article as .pdf.
Szibora U, Schneider-Stock R, Augustin C, Benecke M, Elias S, Harada S, Landt O, Lass U, Pham Hung Vang Schmerbacha K, Wittiga H, Szibor R
Abstract
We examined the mitochondrial (mt) loci nt00073 and nt16519 which show a considerable variability among European populations. These polymorphisms are easily detectable by means of PCR-based RFLP analysis. The study was also aimed at establishing the Light Cycler™ technique for application to forensic mt analysis. In analysing the loci nt00073 and nt16519, both methods provide very easy access and yield compatible results. We found that nt00073 is highly variable in German and Syrian populations and fairly homogeneous among Vietnamese, Japanese, Peruvians and Cameroonians.
Locus nt16519 is highly variable in all populations investigated. However, in contrast to nt00073, its contribution to the mitochondrial potential for discriminating between various ethnic populations is rather negligible.
Keywords mtDNA, SNP, RFLP, Light Cycler, Population data
1. Introduction
The present study was carried out to evaluate markers which can be used in differentiating between ethnic populations. Such markers are needed in skeleton identification as well as in general forensic case work. The study was also aimed at establishing the Light Cyclerk technique for application to forensic mitochondrial (mt) analysis.
We examined the mt loci nt00073 and nt16519 which show a considerable variability in European populations. Both transitions create restriction sites. Hence, these polymorphisms are easily detectable by means of the PCR-based RFLP analysis Method I. In addition, we used the innovative Light Cyclerk technique that is based on the principle of melting curve analysis [1] Method II.
2. Materials and methods
2.1. Method I
Template DNA was amplified by means of the primers L16517 (CGACATCTGGTTCCTACTTCAGG) and H 00097 (GGTGCTCCGGCTCCAGC) yielding PCR fragments of 189 bp in length. Aliquots were separately digested by HaeIII and ApaL1, electrophoresed and silver stained. The transition at locus L16519 T!C creates an HaeIII restriction site (GGCC). The transition at locus L00073 A!G creates an ApaL1 restriction site (GTGCTC). Hence, these enzymes detect the mutations by cleaving the 189-bp PCR product in 165+24 and 153+36 bp fragments, respectively.
2.2. Method II
For each SNP, primers and two probes (sensor and anchor) were designed (Table 1). The 3Vend of one probe was labelled with a donor fluor, whereas the 5Vend of an adjacent probe was labelled with an acceptor fluor. Fluorescence resonance energy transfer occurs only when both probes hybridize to the amplicon. Therefore, SNP alleles are detectable by measuring the relevant melting curves.
Light Cycler conditions: Ingredients were used with the following final concentrations: 16.6 mM (NH2)4SO4, (GC [Genecraft]) 3.125 mM MgCl2 (GC), 0.5 mM dNTP (GC), 0.5 AM sense primer (TIB [TIB MOLBIOL])), 0.5 AM antisense primer (TIB), 0.15 AM 3VFL probe (TIB) 0.15 AM 5VLC probe (TIB), 12 ng BSA (Sigma), 2.5 U Taq
Polymerase (GC).
Experimental protocol: Initial denaturation (regarding nt16519 and nt00073 analyses): 95 jC/3 min; cycle amplification (regarding nt16519 analysis): 40 95 jC/8s, 60 jC/8s (single), 72 jC/15s; cycle amplification (regarding nt00073 analysis): 40 95 jC/5s, 60 jC/8s (single), 72 jC/15s; melting analysis (regarding nt16519 and nt00073 analysis): 95 C/20s, 38 jC/20s. 85 jC/0s ramping: 0.2 jC/s (continuous); fluorescence settings: F1=1;
F2=15; F3=35.
Allele detection: Temperature curves enable detection of the nt16519 alleles T and C at 45.3 and 49.5 jC, respectively. 2.3. Samples DNA extracted from blood spots of 150 Germans (Ger), 100 Syrians (Syr), 100 Japanese (Jap), 100 Vietnamese (Viet), 100 Peruvians (Per), and 60 Bantu-speaking Cameroonians (Cam) were examined to establish the frequency of the transitions A!G L00073 and T!C at L16519.
3. Results and discussion
Studies of the relevant literature revealed that the nt00073 locus is a highly polymorphic site in Caucasian populations [2] and lowly variable in non-Caucasian populations, such as Japanese and Korean populations [3,4]. Due to its localisation within HVII, this polymorphism is well investigated. The nt16519 locus is situated outside the HVI and HVII regions, i.e. outside the most commonly sequenced regions. Hence, population data for this polymorphic site are rather rare.
This study also compared the suitability of PCR-based RLFP technique and Light Cyclerk technique for mtSNPs investigations. In analysing the loci nt00073 and nt16519 both methods provide very easy access and yield compatible results. But since the Light Cyclerk procedure involves less work and a lower risk of carry-over contamination, it must be considered superior.
We found that nt00073 is highly variable in German and Syrian populations and fairly homogeneous among Vietnamese, Japanese, Peruvians and Cameroonians. The v2 test reveals highly significant differences between Caucasian and non-Caucasian populations. Locus nt16519 is highly variable in all populations investigated (Table 2). However, in contrast to nt00073, its contribution to the mitochondrial potential for discriminating between various ethnic populations is rather negligible. Nonetheless, the nt16519 is one of the most polymorphic mitochondrial sites. Haplotyping of nt00073 and nt16519 provides a high power of discrimination (PD), in particular in the Caucasian populations (Table 3).
References
[1] C.T. Wittwer, K.M. Ririe, R.V. Andrew, D.A. David, R.A. Gundry, U.J. Balis, The LightCycler: a microvolume multisample fluorimeter with rapid temperature control, Biotechniques 22 (1997) 176–181.
[2] S. Lutz, H.J. Weisser, J. Heizmann, S. Pollak, Location and frequency of polymorphic positions in the mtDNA control region of individuals from Germany, Int. J. Legal Med. 111 (1998) 67– 77.
[3] S. Horai, K. Murayama, K. Hayasaka, S. Matsubayashi, Y. Hattori, G. Fucharoen, S. Harihara, K.S. Park, K. Omoto, I.H. Pan, MtDNA polymorphism in east Asian populations, with special reference to the peopling of Japan, Am. J. Hum. Genet. 59 (1996) 579–590.
[4] H. Pfeiffer, R. Steighner, R. Fisher, H. Mornstad, C.L. Yoon, M.M. Holland, Mitochondrial DNA extraction and typing from isolated dentin—experimental evaluation in a Korean population, Int. J. Legal Med. 111 (1998) 309– 313.
Coding or non-coding
That is the question
Six forensic entomology cases
Description & considerations
Homicide in the Ukraine
Skull & bone fragments